zeta probe nylon membrane (Bio-Rad)

Bio-Rad is a verified supplier

Bio-Rad manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad zeta probe nylon membrane
Zeta Probe Nylon Membrane, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 4253 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zeta+probe+nylon+membranes/Membrana+Zeta-Probe/pmc13173289-41-35-38
Average 96 stars, based on 4253 article reviews

zeta probe nylon membrane - by Bioz Stars, 2026-09

96/100 stars

Images

other:

Article Title: The cap-independent translational regulation of NbRabGAP1 in Nicotiana benthamiana during BaMV infection
Article Snippet: The resolved RNA was transferred onto Zeta-probe nylon membranes (Bio-Rad Laboratories, Hercules, CA, USA; Cat. No. 162-0190) ( ).

Article Title: Elevated reactive oxygen species can drive the alternative lengthening of telomeres pathway in ATRX-null cancers.
Article Snippet: The gel was transferred overnight to Zeta-Probe nylon membranes (BioRad) through capillary action.

Article Title: Elevated reactive oxygen species can drive the alternative lengthening of telomeres pathway in ATRX-null cancers
Article Snippet: The gel was transferred overnight to Zeta-Probe nylon membranes (BioRad) through capillary action.

Electrophoresis:

Article Title: Alternative translation initiation by ribosomal leaky scanning produces multiple isoforms of the Pif1 helicase
Article Snippet: .. After electrophoresis, DNA fragments were blotted onto Zeta-Probe nylon membranes (Bio-Rad, #1620159) by the alkaline transfer method, according to manufacturer’s instructions. .. Synthesis of the labelled probes, membrane hybridization and detection were performed using DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche, #11585614910) as per the manufacturer’s instructions.

Article Title: Alternative translation initiation by ribosomal leaky scanning produces multiple isoforms of the Pif1 helicase
Article Snippet: .. After electrophoresis, DNA fragments were blotted onto Zeta-Probe nylon membranes (Bio-Rad, #1620159) by the alkaline transfer method, according to manufacturer's instructions. .. Synthesis of the labelled probes, membrane hybridization and detection were performed using DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche, #11585614910) as per the manufacturer's instructions.

Positive Control:

Article Title: Subgingival Prevalence and Antibiotic Susceptibility of Selenomonas noxia
Article Snippet: .. Selenomonas noxia DNA probe testing of subgingival specimens Subgingival biofilm specimens per each study subject, 10 4 and 10 6 cells/mL of S. noxia ATCC 43541 as a positive control, and Prevotella buccae ATCC 33574 and TE buffer alone as negative controls were dot-blot applied to the surfaces of positively charged Zeta-Probe nylon membranes (Bio-Rad Laboratories, Richmond, CA, USA). ..

Staining:

Article Title: Key RNA-binding domains in the La protein establish tRNA modification levels in Trypanosoma brucei
Article Snippet: .. The RNA in gels were visualized using ethidium bromide staining for 10 min and then, electroblotted into Zeta probe nylon membranes for 2 h at 200 mA at 4°C according to the manufacturer's protocol (Bio-Rad). ..

Fractionation:

Article Title: Preclinical development of lentiviral vector gene therapy for Diamond-Blackfan anemia syndrome.
Article Snippet: RNA was isolated from HSPCs using RNeasy kit (Qiagen, #74034) according to 444 the manufacturer’s protocol. .. After gel fractionation on a 1.5% formaldehyde-agarose gel, the RNA 445 was transferred onto zeta-probe nylon membranes (Bio-Rad, #1620153). .. Subsequently, 32P-446 labeled ITS1 probes (CCTCGCCCTCCGGGCTCCGTTAATGA) were hybridized with the 447 membrane overnight at 37°C in hybridization buffer (Ambion, #AM8670) prior to 448 phosphorimaging.

Review